JVDI Advertisement
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Veterinary Diagnostic Investigation Vol. 20 Issue 6, 780-782
Copyright © 2008 by the American Association of Veterinary Laboratory Diagnosticians
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pregel, P.
Right arrow Articles by Appino, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pregel, P.
Right arrow Articles by Appino, S.

Brief Research Reports

Detection of Helicobacter in gastric washing of cats

Paola Pregel1, Ada Rota, Domenico Palmerini, Franco Guarda and Simonetta Appino

Correspondence: 1Corresponding Author: Paola Pregel, Dipartimento di Patologia Animale, Università degli Studi di Torino, via L. Da Vinci 44, 10095 Grugliasco (Torino), Italy. paola.pregel{at}unito.it


    Abstract
 TOP
 Abstract
 Sources and manufacturers
 References
 
The aim of the current study was to evaluate the efficacy of gastric washing for detecting the presence of Helicobacter spp. in feline gastric mucus. Gastric fluids were collected from 11 cats undergoing routine surgical procedures. The fluids were centrifuged and the pellets were subjected to cytological examination by May–Grünwald/Giemsa (MGG) staining and testing by polymerase chain reaction (PCR) for the presence of Helicobacter after DNA extraction. Helicobacter spp. were detected in 8 of 11 samples by MGG staining and in 10 of 11 samples by PCR. Gastric washing proved to be a useful sampling technique and a valuable alternative to the gold-standard method of gastric biopsy, which has the risk of missing colonized spots in the case of patchy Helicobacter colonization. Gastric washing, a noninvasive way of sampling, could be applied to cats undergoing general anesthesia for different causes. Detection of Helicobacter in cats could allow epidemiological investigations, and sequencing of samples could assist in assessing the distribution of various Helicobacter species.

Key Words: Cats • Helicobacter • stomach • washing

Gastric bacteria categorized in the genus Helicobacter are Gram negative and spiral shaped; at least 24 species have been reported, and most Helicobacter spp. are suspected or proved gastric or hepatic pathogens in humans.7 Helicobacter pylori, colonizing the stomach of half of the world's human population, is a proven primary cause of gastritis and peptic ulceration4 and is considered a major risk factor in the development of mucosa-associated lymphoid tissue lymphoma22 and gastric adenocarcinoma.19

Studies of the relationship between gastric disease and Helicobacter spp. infection in animals have resulted in the discoveries of Helicobacter mustelae in ferrets with gastritis and peptic ulcers, Helicobacter acinonychis in cheetahs with severe gastritis, and Helicobacter heilmannii in pigs with gastric ulcers.5,8,21 The role of Helicobacter spp. in gastrointestinal disease in dogs and cats is uncertain. It is known that virtually all healthy adult cats harbor spiral helicobacter in their gastric mucosa, but the clinical significance and ecology of this microorganism within the stomach of domestic carnivores remain largely unknown.12 The marked morphological resemblance and the genetic relatedness between the spiral organisms identified in both animal and human gastric tissues led to the hypothesis that spiral gastric bacteria are zoonotic agents. The high prevalence of these gastric Helicobacter spp. in animals,2,12 in contrast with their low prevalence in humans,1,11 strongly indicates that animals may act as natural reservoirs for transmission to humans.3 The frequent detection of gastric Helicobacter-like organisms (GHLOs) in the cat led to the hypothesis that feline Helicobacter spp. may be transmitted to humans.10,11,17

Diagnostic tests for Helicobacter spp. can be noninvasive, as is the urea breath test, or invasive, as is biopsy. Breath samples can be obtained either through the endotracheal tube in anesthetized cats or, in conscious, cooperating animals, through a face mask.15 Gastroscopy requires general anesthesia and should always be followed by biopsy because the mucosa may appear macroscopically normal but may nevertheless be inflamed,24 and a tissue sample is essential for histopathological examinations and strain identification. However, in cases of patchy Helicobacter colonization, biopsy sampling has the risk of missing colonized spots. Some authors reported that the prevalence of Helicobacter spp. detected in gastric biopsies using polymerase chain reaction (PCR) technique was low, because the results could be affected by factors such as sampling location, specimen preparation, and bacterial density.20 The aim of the current study was to evaluate a novel noninvasive sampling technique, gastric washing followed by May–Grünwald/Giemsa (MGG) staining or PCR, to detect the presence of Helicobacter spp. in feline gastric mucus.

Eleven privately owned cats (4 males and 7 females), ranging between 2 and 16 years of age, undergoing routine surgical procedures were included in the study. Owner consent was obtained for all cats. After a 12-hr fasting, all cats were intubated and anesthetized with isoflurane in oxygen. Before the scheduled surgery, the animals were placed in left lateral recumbency, and gastric washing was performed using a gastric tube (4.0 mm in diameter). Ten milliliters of sterile saline solution was slowly injected into the stomach and almost immediately retrieved through a syringe. The fluid was centrifuged (5 min, 3,000 x g), the supernatant removed, and the pellet resuspended in 500 µl of phosphate buffered saline. The resuspension was split into 2 pieces, and one part was subjected to cytocentrifugation (100 µl, 5 min, 22.4 x g in a Shandon Cytospin 2 centrifuge) for cytological examination following MGG staining.6 The other part was used for DNA extraction for PCR. DNA extraction was carried out by a commercial tissue extraction kit.a The extracted DNA was subjected to PCR using specific primers that amplify a fragment of the 16S ribosomal RNA (rRNA) gene of Helicobacter spp.

Polymerase chain reaction was performed using 0.5 U of Taq DNA polymerase, 10 mmol of Tris HCl, 50 mmol of KCl, 1.5 mmol of MgCl2, 200 µmol deoxyribonucleotide triphosphate, and 25 µmol of each primer (sense primer: innS [GAACCTCTAGGCTTGACATTG] and antisense primer: innR [GGTGAGTACAAGACCCGGGAA]). The samples were subjected to 30 amplifying cycles at the following temperatures: denaturation at 94°C for 30 sec, annealing at 47°C for 30 sec, and extension at 72°C for 30 sec. Products from the PCR were evaluated by means of 7% polyacrylamide gel electrophoresis, comparing the obtained amplicons to a DNA molecular weight marker.b Five of the 11 amplified products from the samples were further purified from agarose gel by means of a commercial extraction kitc and were sequenced.d

Helicobacter was detected in 8 of 11 samples by MGG staining and in 10 of 11 samples by PCR. May–Grünwald/Giemsa–stained cytological samples showed dark-purple spiral microorganisms, presumptive of Helicobacter spp. (Fig. 1). Polymerase chain reaction–positive samples presented a typical 420–base pair fragment of the 16S rRNA gene. Nucleotide sequencing reflected sequences with a homology range of 99–100%, with a partial sequence from 16S rRNA gene of H. heilmannii and an uncultured Helicobacter sp. from a cheetah.16,23


Figure 01
View larger version (137K):
[in this window]
[in a new window]

 
Figure 1 Massive presence of Helicobacter in feline gastric washing. May–Grünwald/Giemsa stain. 1,000x.

 
Gastric washing proved to be a useful noninvasive technique to detect the presence of Helicobacter spp. in cat stomachs. In the current study, gastric washing showed a prevalence of 90.9% of Helicobacter spp., which is in accordance with results of previous investigations, reporting values ranging from 57% to 100% in gastric biopsies.9 A previous study15 showed that the urea breath test can be a reliable noninvasive diagnostic method as well, although it is not useful for species identification. At present, the gold standard of diagnostic tests in cats is considered to be gastric biopsy followed by morphological observations and PCR for species differentiation.15 Results from the present study indicate that MGG staining represents a useful and uncomplicated way to detect the presence of the microorganism,15 although PCR may be a more sensitive method of detection when few bacteria are present.

Results from the current study also indicate that cats are frequently colonized by H. heilmannii without showing any gastrointestinal symptoms.15,18 Previous studies that differentiated Helicobacter spp. (e.g., PCR or electron microscopy) showed that H. heilmannii–like species were the most commonly found GHLO in the stomach of the cat, Helicobacter felis could be isolated less frequently, and the presence of H. pylori remains anecdotal.15 Also, infection with more than 1 species may occur.13,14 The role of the cat as a reservoir of zoonotic agents should be investigated further, not only because a small proportion (approximately 0.25–1.7%) of human patients suffering from gastritis, peptic ulcers, and gastric cancer are diagnosed with gastric Helicobacter-like bacteria other than H. pylori,11 but because a previous study10 that detected H. pylori in cats indicated that the cat might represent a reservoir for this bacterium, whose natural host is human.

The great majority of GHLOs of carnivorous pets are confined to the mucus layer (Lecoindre P, Chevallier M, Berger I, Peyrol S: 1997, Contribution to the study of gastric helicobacters. Ultrastructural aspects of the cat gastric mucosa. In: European Society of Veterinary Internal Medicine Congress Proceedings. Ecole Nationale Veterinaire de Lyon, Lyon, France, p. 166), and gastric washing could, therefore, be a valuable technique to sample the entire gastric mucosa, avoiding the need to select the biopsy area and the risk of missing colonized spots. Gastric washing, an uncomplicated and noninvasive method of sampling, could be applied to cats submitted to general anesthesia for different causes, thus allowing epidemiological investigations on transmission of these bacteria. Furthermore, sequencing the samples would allow the assessment of species distribution in the stomach and the evaluation of whether H. pylori and H. heilmannii are potential zoonotic agents. The relationship between DNA sequence of Helicobacter spp. found in cats and in their owners could determine if these bacteria are zoonotic agents that may have important public health implications.

The proposed technique could also be of clinical relevance, since it might increase the rate of Helicobacter detection during patchy mucosal colonization. The method could also be used in association with endoscopy and biopsy for symptomatic cats to assess the distribution of inflammation and the location of the bacteria in tissues. Because the role of Helicobacter in cat gastritis has not been fully elucidated, further investigation of feline gastric pathology is needed to understand strain-dependent virulence.


    Acknowledgments
 
The authors wish to thank Drs. Federico Stoppani and Elio Bossi, small animal practitioners in Ospedaletti (IM) and Sanremo (IM), Italy, for sample collection.


    Sources and manufacturers
 TOP
 Abstract
 Sources and manufacturers
 References
 
From the Dipartimento di Patologia Animale, Università degli Studi di Torino, Grugliasco, Torino, Italy (Pregel, Rota, Palmerini, Guarda, Appino), and the Istituto di Patologia Generale, Anatomia Patologica e Clinica Ostetrico-Chirurgica Veterinaria, Università degli Studi di Sassari, Sassari, Italy (Appino). Back

a. NucleoSpin® Tissue Extraction Kit, Macherey-Nagel, Düren, Germany. Back

b. DNA Molecular Weight Marker V, Roche Diagnostics, Basel, Switzerland. Back

c. NucleoSpin® Extract Kit, Macherey-Nagel, Düren, Germany. Back

d. BMR Genomics Srl, Padova, Italy. Back


    References
 TOP
 Abstract
 Sources and manufacturers
 References
 

  1. Debongnie J.C. 1994 Gastrospirillum hominis prevalence [letter]. Dig Dis Sci 39 1618 pp.[Medline]
  2. De Groote D., Haesebrouck F., van Doorn L.J., et al. 2001 Evaluation of a group-specific 16S ribosomal DNA-based PCR for detection of Helicobacter bizzozeronii, Helicobacter felis, and Helicobacter salomonis in fresh and paraffin-embedded gastric biopsy specimens. J Clin Microbiol 39 1197 1199.[Abstract/Free Full Text]
  3. De Groote D., Van Doorn L.J., Van den Bulck K., et al. 2005 Detection of non-pylori Helicobacter species in "Helicobacter heilmannii"-infected humans. Helicobacter 10 398 406.[Medline]
  4. Dunn B.E., Cohen H., Blaser M.J. 1997 Helicobacter pylori. Clin Microbiol Rev 10 720 741.[Abstract]
  5. Eaton K.A., Radin M.J., Kramer L., et al. 1993 Epizootic gastritis associated with gastric spiral bacilli in cheetahs (Acinonyx jubatus). Vet Pathol 30 55 63.[Abstract]
  6. Fournel-Fleury C., Magnol J-P., Guelfi J-F. 1994 General principles of methodology and interpretation in cancer cytology. In: Atlas en couleur de cytologie du cancer chez le chien et le chat [Color atlas of cancer cytology of the dog and cat] In French. Paris, France Conférence Nationale des Vétérinaires Spécialisés en Petit Animaux 23.
  7. Fox J.G. 2002 The non-H. pylori helicobacters: their expanding role in gastrointestinal and systemic diseases. Gut 50 273 283.[Abstract/Free Full Text]
  8. Fox J.G., Correa P., Taylor N.S., et al. 1990 Helicobacter mustelae-associated gastritis in ferrets. An animal model of Helicobacter pylori gastritis in humans. Gastroenterology 99 352 361.[Medline]
  9. Geyer C., Colbatzky F., Lechner J., et al. 1993 Occurrence of spiral-shaped bacteria in gastric biopsies of dogs and cats. Vet Rec 133 18 19.[Medline]
  10. Handt L.K., Fox J.G., Dewhirst F.E., et al. 1994 Helicobacter pylori isolated from the domestic cat: public health implications. Infect Immun 62 2367 2374.[Abstract/Free Full Text]
  11. Heilmann K.L., Borchard F. 1991 Gastritis due to spiral shaped bacteria other than Helicobacter pylori. Clinical, histological and ultrastructural findings. Gut 32 137 140.[Abstract/Free Full Text]
  12. Jalava K., On S.L., Vandamme P.A., et al. 1998 Isolation and identification of Helicobacter spp. from canine and feline gastric mucosa. Appl Environ Microbiol 64 3998 4006.[Abstract/Free Full Text]
  13. Lecoindre P., Chevallier M., Peyrol S., et al. 1997 Pathogenic role of gastric Helicobacter sp. in domestic carnivores. Vet Res 28 207 215.[Medline]
  14. Lee A., Hazell S.L., O'Rourke J., Kouprach S. 1988 Isolation of a spiral-shaped bacterium from the cat stomach. Infect Immun 56 2843 2850.[Abstract/Free Full Text]
  15. Neiger R., Dieterich C., Burnens A., et al. 1998 Detection and prevalence of Helicobacter infection in pet cats. J Clin Microbiol 36 634 637.[Abstract/Free Full Text]
  16. O'Rourke J.L., Solnick J.V., Neilan B.A., et al. 2004 Description of ‘Candidatus Helicobacter heilmannii’ based on DNA sequence analysis of 16S rRNA and urease genes. Int J Syst Evol Microbiol 54 2203 2211.[Abstract/Free Full Text]
  17. Otto G., Hazell S., Fox J.G., et al. 1994 Animal and public health implications of gastric colonization of cats by Helicobacter-like organisms. J Clin Microbiol 32 1043 1049.[Abstract/Free Full Text]
  18. Papasouliotis K., Gruffydd-Jones T.J., Werret G., et al. 1997 Occurrence of ‘gastric Helicobacter like organisms’ in cats. Vet Rec 140 369 370.[Free Full Text]
  19. Parsonnet J., Friedman G.D., Vandersteen D.P., et al. 1991 Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med 325 1127 1131.[Abstract]
  20. Prachasilpchai W., Nuanualsuwan S., Chatsuwan T., et al. 2007 Diagnosis of Helicobacter spp. infection in canine stomach. J Vet Sci 8 139 145.[Medline]
  21. Queiroz D.M., Rocha G.A., Mendes E.N., et al. 1996 Association between Helicobacter and gastric ulcer disease of the pars esophagea in swine. Gastroenterology 111 19 27.[Medline]
  22. Stolte M., Eidt S. 1993 Healing gastric MALT lymphomas by eradicating H. pylori? Lancet 342 568 pp.[Medline]
  23. Terio K.A., Munson L., Marker L., et al. 2005 Comparison of Helicobacter spp. in cheetahs (Acinonyx jubatus) with and without gastritis. J Clin Microbiol 43 229 234.[Abstract/Free Full Text]
  24. Vaira D., Holton J., Menegatti M., et al. 2000 Review article: invasive and noninvasive tests for Helicobacter pylori infection. Aliment Pharmacol Ther 14 (Suppl 3) 13 22.[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pregel, P.
Right arrow Articles by Appino, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pregel, P.
Right arrow Articles by Appino, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS