Journal of Veterinary Diagnostic Investigation Vol. 18 Issue 6, 627-631
Copyright © 2006 by the American Association of Veterinary Laboratory Diagnosticians
Spontaneous subcutaneous myxosarcoma in a captive European hedgehog (Erinsceus europaeus)
Kuldeep Singh1,
Uriel Blas-Machado,
Emily J. Cooper,
Shannon L. Caseltine and
Robert Nordhausen
Correspondence: 1Corresponding Author: Kuldeep Singh, Department of Veterinary Pathobiology, McElroy Hall 250, Oklahoma State University, Stillwater, OK 74078
 |
Abstract
|
|---|
A surgically excised biopsy representing a subcutaneous mass on the left side of the neck from a 3-year-old female European hedgehog (Erinsceus europaeus) was presented. Spontaneous myxosarcoma was diagnosed based on histological, immunohistochemical, and ultrastructural characteristics. The neoplasm grossly consisted of a firm, pale, multilobulated mass with a characteristic clear gelatinous fluid. Histologically, the neoplasm was nonencapsulated and composed of pleomorphic stellate or spindle-shaped vimentin and periodic acidSchiff-positive cells arranged in loose sheets and occasionally whorls. The neoplastic cells were suspended in Alcian bluepositive stroma and contained infrequent mitotic figures. Evidence of a viral etiology was not detected using electron microscopy and polymerase chain reaction. This is the first case report of a myxosarcoma in a captive European hedgehog.
Key Words: Hedgehog histology myxosarcoma neoplasia
Myxosarcomas and myxomas are rare tumors of primitive fibroblasts that produce excessive mucin, a myxoid matrix rich in acid mucopolysaccharides. Whereas these tumors have been reported in humans and several animals,1,13,14,17,23,24 there are no reports in the literature about their occurrence in the European hedgehog. Neoplastic disease is relatively common in adult captive hedgehogs.20 In 1 retrospective study, 40 tumors were diagnosed in 35 (53%) of 66 cases of adult African hedgehog submissions. Of the 40 tumors, 34 (85%) were classified as malignant, whereas 6 (15%) were classified as benign.20 The integumentary, hemic and lymphatic, digestive, and endocrine systems are the most common anatomic locations for neoplastic disease in hedgehogs, and the most common tumors are mammary gland adenocarcinoma, lymphosarcoma, oral squamous cell carcinoma, and cutaneous mast cell tumors.20 Other tumors reported in hedgehogs include granulosa cell tumor, thyroid c-cell carcinoma, malignant peripheral nerve sheath tumor, pituitary adenoma, uterine adenocarcinoma and leiomyosarcoma, subcutaneous osteosarcoma and schwannoma, and cutaneous fibrosarcoma and hemangiosarcoma.2,4,9,16,19,20,22,25 Myxosarcomas associated with viral agents have been documented in rabbits infected with rabbit fibroma virus10 and golden hamsters.6 Retroviral particles have been detected using electron microscopy in an African hedgehog with multicentric skeletal sarcomas18 and intestinal lymphosarcoma.21 This report documents a spontaneous subcutaneous myxosarcoma in a hedgehog based on histological, immunohistochemical, and ultrastructural characteristics.
A surgically excised biopsy from a 3-year-old female European hedgehog with a subcutaneous mass on the left side of the neck, distinctly separate but adjacent to the thyroid gland, was submitted to the Oklahoma Animal Disease Diagnostic Laboratory. On gross examination, the tissue specimen consisted of a firm, irregular, pale tan/red multilobulated mass (4 x 4 x 3 cm) with an indistinct fibrous capsule and adipose tissue attachments. On the cut surface, the mass was subdivided into distinct pale pink lobules by pale yellow/tan fibrous bands. A clear, stringy gelatinous (mucinous) fluid oozed from the cut surfaces (Fig. 1).

View larger version (122K):
[in this window]
[in a new window]
|
Figure 1 Myxosarcoma, European hedgehog. Region of the subcutaneous mass on the left side of the neck near the thyroid gland as submitted. There is a clear, stringy gelatinous (mucinous) fluid oozing for the surface (arrow) and discrete hemorrhages. Bar = 0.4 cm.
|
|
Tissue sections were fixed overnight in neutral buffered 10% formalin solution. Representative tissue sections were trimmed, routinely processed, embedded in paraffin, sectioned at approximately 5 microns, stained with hematoxylin and eosin, periodic acidSchiff, reticulin, toluidine blue, and Alcian blue (pH 2.5) and evaluated for microscopic lesions. Additional sections were immunostained for reactivity with cytokeratin, vimentin, factor VIII, neuron specific enolases (NSE), and S100 by the streptavidinhorseradish peroxidase conjugate method. When applicable, sections were stained with normal mouse or rabbit serum to serve as negative controls. All immunohistochemical stains were counterstained with Mayer hematoxylin. These immunostains have not yet been validated in hedgehogs. Therefore, positive controls consisted of different tissues from hedgehog with positive immunostaining of the expected structures.
Polymerase chain reaction (PCR) was performed to determine if the neoplasm contained myxoma viral DNA. For the PCR assay, DNA was isolated from the formalin-fixed and formalin-fixed, paraffin-embedded tissues using a commercially available kit.a The tumor was tested for the presence of myxoma virus DNA sequence. Primers JB13 (nucleotide positions 1806918085, CATGAATTCAGCGTCTGTAGTCGCGGC) and JB14 (nucleotide positions 1785817875, CATGGATCCTTAATTTAGTAAAGGAAC) of the myxoma virus genome were used.b Standard PCR was conducted using commercial reagents: 1x PCR buffer,c 1.5 mM MgCl2, 0.2 µM dNTPs, 0.5 µM of each primer, 0.5 µl of Taq DNA polymerase,c and 5 µl of DNA in a 50-µl reaction. Cycling protocol was developed as follows: 95°C for 5 minutes, followed by 35 cycles of 94°C for 20 seconds, 50°C for 20 seconds, and 72°C for 30 seconds, and a final extension at 72°C for 10 minutes. Cloned genomic DNA of myxovirus was used as a positive control.b The positive control revealed an amplified product of the expected size (250 base pairs) whereas no band was detected in the test sample obtained from the neoplasm.
Electron microscopic examination was conducted to demonstrate viral particles in the neoplasm, if any. For electron microscopy, the tissue was collected in 20% glutaraldehyde. The tissue was subsequently transferred to modified (half strength) Karnovsky fixative before postfixation in 2% osmium tetroxide reduced with 2.5% potassium ferrocyanide. Following osmification, the tissue was washed in 0.2 M sodium cacodylate and dehydrated through a graded ethanol series before infiltration and embedment in Spurr epoxy resin. Thick sections (500 nm) were cut, mounted on glass slides, and stained with toluidine blue O. Thin sections (70 nm) were cut, mounted on 150-mesh copper grids, stained with 6% methanolic uranyl acetate and Reynolds lead citrate, and examined in a LEO 906E transmission electron microscoped at 60 kv accelerating voltage.
Histopathological examination of the tissue revealed a nonencapsulated, expansile, and infiltrative moderately cellular neoplasm. Neoplastic cells were arranged in loose sheets, clusters, and occasionally whorls. In some regions, cells were more numerous and closely apposed. The cells were embedded in amphophilic, vacuolated Alcian bluepositive mucinous stroma (Figs. 2, 3). Frequently the neoplasm was subdivided by short bundles of collagenous tissue septae. Individual tumor cells were pleomorphic, stellate- or spindle-shaped, and contained variable quantities of amphophilic to eosinophilic, granular, periodic acidSchiff-positive cytoplasm with indistinct cell borders (Figs. 2, 4). Occasionally, cells contained few, small intracytoplasmic vacuoles lined by irregular borders. The hyperchromatic nuclei were predominantly single, variably sized, round to oval, with distinct often indented nuclear membrane, stippled chromatin, and single prominent nucleoli. Mitotic figures were infrequent (less than 1 per high power field). Foci of vascular invasion and neoplastic cell emboli were observed occasionally. Dispersed in the neoplasm were extensive areas of hemorrhage and necrosis, with scattered clusters of foamy macrophages and lymphocytes. Immunohistochemically, approximately 7080% of neoplastic cells exhibited strong reactivity with vimentin whereas cytokeratin, factor VIII, NSE, and S100 were negative. The neoplastic cells did not stain with the toluidine blue for metachromatic granules of mast cells.

View larger version (144K):
[in this window]
[in a new window]
|
Figure 2 Myxosarcoma, European hedgehog. Neoplastic cells are pleomorphic with moderately abundant, pale eosinophilic, granular cytoplasm with indistinct cell borders. The hyperchromatic nuclei are round to oval with moderate anisokaryosis and prominent nucleoli. Occasionally, neoplastic cells are multinucleated (arrow). Hematoxylin and eosin stain. Bar = 33 µm.
|
|

View larger version (145K):
[in this window]
[in a new window]
|
Figure 3 Myxosarcoma, European hedgehog. The mucinous stroma stains positive for acid mucopolysaccharides (arrow). Alcian blue stain (pH 2.5). Bar = 33 µm.
|
|

View larger version (138K):
[in this window]
[in a new window]
|
Figure 4 Myxosarcoma, European hedgehog. Cytoplasmic granules within neoplastic cells stain positive for complex carbohydrates (arrow). Periodic acidSchiff stain. Bar = 33 µm.
|
|
Ultrastructural analysis revealed suboptimally preserved tissue containing extracellular matrix and debris isolating the neoplastic cells. The neoplastic cells contained decreased numbers of normal cytoplasmic organelles and were surrounded by indistinct cell borders with conspicuous rims of cytoplasmic extensions interconnecting to form an irregular lattice (Fig. 5). The cytoplasm contained variably sized, clear vacuoles outlined by poorly defined borders, occasional irregular homogenous and poorly demarcated dense material, and clusters of well demarcated glycogen-like dense material. Rarely whorled structures composed of alternating dense and light bands arranged in lamellar arrays were also observed. These structures are considered nonspecific cytologic proliferation of cytoplasmic membranes.11 The nuclei in the neoplastic cells were large, multiple, and anisokaryotic and contained abnormal chromatin arranged predominantly in peripheral clumps surrounded by irregular nuclear membranes with numerous invaginations. The gross, microscopic, and ultrastructural characteristics of this tumor are similar to myxosarcoma documented in domestic animals and humans.11

View larger version (220K):
[in this window]
[in a new window]
|
Figure 5 Myxosarcoma, European hedgehog. The cells contain aberrant interconnecting cytoplasmic extensions and are outlined by irregular cell borders. Note relatively sparse intracytoplasmic organelles and anisokaryotic nuclei with peripheral aggregated chromatin. Transmission electron microscopy. Uranyl acetatelead citrate stain. Bar = 5 µm.
|
|
Neoplasms that may histologically appear similar to myxosarcoma include mucoepidermal carcinoma, thyroid carcinoma, hemangiopericytoma, malignant peripheral nerve sheath tumor, and myxoid liposarcoma.5,7,8 The absence of cytokeratin staining in this case does not support epithelial origin. Moreover, neoplastic cells in mucoepidermoid carcinoma are arranged in solid masses or form the lining of cysts and may protrude as papillae into the cyst lumen.7 These histological characteristics were not observed in this case. Interestingly, this neoplasm was located adjacent to the thyroid gland and shared some of the histological characteristics of the compact cellular thyroid carcinoma and giant cell thyroid carcinoma derived from follicular cells and undifferentiated thyroid carcinoma.3 However, the absence of cytokeratin immunoreactivity and the lack of ultrastructural junctional complex and microvilli in this case does not support thyroid gland origin.3 It is relatively difficult to histologically and ultrastructurally distinguish hemangiopericytoma and peripheral nerve sheath tumor.5 Ultrastructural features ascribed to hemangiopericytoma cells include, among others, intracytoplasmic filaments, which were not observed in the present case.26 Moreover, the lack of factor VIII immunoreactivity in the whorls of neoplastic cells supports the diagnosis of myosarcoma. Some of the malignant peripheral nerve sheath tumors stain positive with S-100 and NSE, and ultrastructurally some neoplastic cells contain prominent basal lamina, a feature that was not observed in this case.5 Dramatic and intense reticulin staining that is observed in the peripheral nerve sheath tumors was also lacking in this case. The myxoid variant of liposarcoma consist of scattered stellate to spindle cells, lipocytes, and lipoblasts arranged in Alcian bluepositive mucoid stroma.5 The lipocytes are histologically characterized by a large lipid droplet compressing the nucleus on the periphery in a "half-moon" shape.5 Similar cells were not observed in this case. Foamy macrophages observed in this case contained multiple, clear intracytoplasmic vacuoles with centrally placed round nuclei. Some of these vacuoles contained Alcian bluepositive contents, presumably phagocytized mucinous stroma. Additionally, round electron dense intracytoplasmic lipid droplets and microfilaments described previously in a myxoid liposarcoma15 were not observed ultrastructurally in this case.
Adequate histological criteria have not been developed to distinguish benign from the malignant myxoid neoplasm in animals. In contrast to benign myxoid neoplasms, which are characterized by hypocellularity, lack of cellular atypia, and poor vascularization, the features of this neoplasm were consistent with a myxosarcoma.8 Because myxosarcomas are infiltrative and difficult to remove completely at surgery, local recurrence is frequently reported. However, metastasis is rare in domestic animals.5,8 The hedgehog died suddenly after 4 months. Although the hedgehog was not presented for postmortem evaluation, it is possible that it died of metastatic disease because there was histological evidence of metastasis. Although this is the only case of myxosarcoma reported in hedgehog, the absence of reports of a benign myxoma and presumably metastatic behavior in this case suggest that these tumors are likely to metastasize in hedgehogs as compared to domestic animals where metastasis is rare. Therefore, consideration of a stringent clinical management for myxosarcoma is required in hedgehogs.
The underlying etiology of myxosarcoma in this case remains undetermined. Whereas a viral etiology was initially suspected, it was not detected either by electron microscopic examination or by PCR assay. The inability to detect viral genome in a formalin-fixed tissue may have been related to the process of tissue fixation with formalin, which results in cross-linking between proteins and DNA and between different strands of DNA and, subsequently, in fragmentation of nucleic acids, thus, reducing the efficiency of amplifying DNA.12
 |
Acknowledgments
|
|---|
The authors wish to thank Dr. Grant McFadden, Robarts Research Institute, Department of Microbiology and Immunology, University of Western Ontario, Ontario, Canada for his generous gifts of PCR primers. The assistance of Aaron Richardson in preparing the manuscript and Ms. Jeanenne Duffy and Mr. Brent Johnson for the immunohistochemical staining is appreciated.
 |
Sources and manufacturers
|
|---|
From the Department of Veterinary Pathobiology, Oklahoma State University, Stillwater, OK 74078 (Singh), Athens Veterinary Diagnostic Laboratory, College of Veterinary Medicine. The University of Georgia, Athens, GA 30602 (Blas-Machado), Oklahoma Animal Disease Diagnostic Laboratory, Stillwater, OK 74078 (Cooper, Caseltine), and the California Animal Health and Food Safety System, University of California, Davis, CA 95616 (Nordhausen). 
a. MagneSil Genomic, Fixed Tissue System, catalog number MD1490, Promega Corporation, Madison, WI. 
b. Dr. Grant McFadden, Robarts Research Institute, Department of Microbiology and Immunology, University of Western Ontario, Ontario, Canada. 
c. Promega Corporation, Madison, WI. 
d. Carl Zeiss SMT AG, Oberkochen, Germany. 
 |
References
|
|---|
- Blumenthal H.T., Rogers J.B.: 1967, Spontaneous and induced tumors in the guinea pig, with special reference to the factor of age. Prog Exp Tumor Res 9:261285.[Medline]
- Campbell D.J., Smith W.T.: 1966, A pituitary adenoma in a hedgehog (Erinaceus europaeus). Endocrinology 79:842844.[Abstract/Free Full Text]
- Capen C.C.: 2002, Tumors of endocrine glands. In: Tumors in domestic animals, ed. Meuten D.J., 4th ed., pp. 607696. Iowa State Press, Ames, IA.
- Frye F.L., Dutra F.R.: 1973, Squamous cell carcinoma of the feet of an Indian hedgehog. J Wildlife Dis 9:249250.[Abstract/Free Full Text]
- Goldschmidt M.H., Hendrick M.J.: 2002, Tumors of skin and soft tissues. In: Tumors in domestic animals, ed. Meuten D.J., Iowa State Press, 4th ed., pp. 9199. Ames, IA.
- Graffi I., Waldeyer R., Bierwolf D., et al.: 1967, [Demonstration of a virus in a transplantable myxosarcoma of the golden hamster]. Acta Biol Med Ger 19:10171027.[Medline]
- Head K.W., Else R.W., Dubielzig R.R.: 2002, Tumors of alimentary tract. In: Tumors in domestic animals, ed. Meuten D.J., 4th ed., pp. 401483. Iowa State Press, Ames, IA.
- Hendrick M.J., Mahaffey E.A., Moore F.M., et al.: 1998, Histological classification of mesenchymal tumors of skin and soft tissues of domestic animals. In: WHO tnternational classification of tumors of domestic animals, ed. Schulman F.Y.S., 2nd series, vol. 2, pp. 1618. Armed Forces Institute of Pathology, Washington DC.
- Hruban Z., Vardiman J., Meehan T., et al.: 1992, Hematopoietic malignancies in zoo animals. J Comp Pathol 106:1524.[Medline]
- Kasza L.: 1974, Isolation and characterization of a rabbit fibroma virus from a naturally occurring tumor. Am J Vet Res 35:8789.[Medline]
- Leak L.V., Caulfield J.B., Burke J.F., McKhann C.F.: 1967, Electron microscopic studies on a human fibromyxosarcoma. Cancer Res. 2:261285.
- Lehmann U., Kreipe H.: 2001, Real-time PCR analysis of DNA and RNA extracted from formalin-fixed and paraffin-embedded biopsies. Methods 25:409418.[Medline]
- Loupal G., Baumgartner W.: 1984, [Myxosarcoma in a heifer]. Tierarztl Prax. 12:173178.[Medline]
- Madewell B.R., Theilen G.H.: 1987, Skin tumors of mesenchymal origin. In: Veterinary cancer medicine, ed Theilen G.H., Madewell B.R., pp. 282309. Lea and Febiger, Philadelphia, PA.
- Messick J.B., Radin M.J.: 1989, Cytologic, histologic, and ultrastructural characteristics of a canine myxoid liposarcoma. Vet Pathol. 6:520522.
- Miller D.L., Styer E.L., Stobaeus J.K., Norton T.M.: 2002, Thyroid c-cell carcinoma in an African pygmy hedgehog (Atelerix albiventris). J Zoo Wildlife Med 33:392396.
- Moe J.B., White J.B., Czajkowski W.P., Stookey J.L.: 1975, Myxosarcoma in a young rhesus monkey. Vet Pathol 12:612.[Abstract]
- Peauroi J.R., Lowenstine L.J., Munn R.J., Wilson D.W.: 1994, Multicentric skeletal sarcomas associated with probable retrovirus particles in two African hedgehogs (Atelerix albiventris). Vet Path 31:481484.[Medline]
- Ramos-Vara J.A.: 2001, Soft tissue sarcomas in the African hedgehog (Atelerix albiventris): microscopic and immunohistologic study of three cases. J Vet Diagn Invest 13:442445.[Abstract/Free Full Text]
- Raymond J.T., Clarke K.A., Schafer K.A.: 1998, Intestinal lymphosarcoma in captive African hedgehogs. J Wildl Dis 34:801806.[Abstract]
- Raymond J.T., Garner M.M.: 2001, Spontaneous tumors in captive African hedgehogs (Atelerix albiventris): a retrospective study. J Comp Path 124:128133.[Medline]
- Rivera R.Y., Janovitz E.B.: 1992, Oronasal squamous cell carcinoma in an African hedgehog (Erinaceidae albiventris). J Wildlife Dis 28:148150.[Abstract]
- Schaff Z., Grimley P.M., Michelitch J., Banfield W.J.: 1973, Spontaneous myxosarcoma in a cottontail rabbit (Sylvilagus floridanus): observation of tubular structures in the endoplasmic reticulum of tumor cells. J Nat Cancer Inst 51:293297.[Medline]
- Snyder S.P., Davies R.B., Keiss R.E.: 1979, Myxosarcoma in a wapiti. J Wildlife Dis 15:307308.[Abstract]
- Wellehan J.F., Southorn E., Smith D.A., Taylor W.M.: 2003, Surgical removal of a mammary adenocarcinoma and a granulosa cell tumor in an African pygmy hedgehog. Can Vet J 44:235237.[Medline]
- Xu F.N.: 1986, Ultrastructure of canine hemangiopericytoma. Vet Pathol 23:643645.[Medline]