Journal of Veterinary Diagnostic Investigation Vol. 18 Issue 5, 472-475
Copyright © 2006 by the American Association of Veterinary Laboratory Diagnosticians
Isolation of Equine Herpesvirus-5 from Blood Mononuclear Cells of a Gelding
Stephanie A. Bell,
Udeni B. R. Balasuriya,
Robert W. Nordhausen and
N James. MacLachlan1
Correspondence: 1 Corresponding Author: N James MacLachlan, Department of Pathology, Microbiology, and Immunology, School of Veterinary Medicine, One Shields Avenue, University of California, Davis, CA 95616, njmaclachlan{at}ucdavis.edu
 |
Abstract
|
|---|
Horses are commonly infected by herpesviruses, but isolation of equine herpesvirus-5 (EHV-5) has only infrequently been reported. We describe the isolation and characterization of a strain of EHV-5 from the blood mononuclear cells of a healthy adult horse in California. The virus was initially identified by EHV-5 specific polymerase chain reaction (PCR), and it caused lytic infection of cultured rabbit kidney cells only after repeated serial passage. Virions with characteristic herpesvirus morphology were readily demonstrated in cell culture lysate by transmission electron microscopy. A portion of the glycoprotein B gene of this strain of EHV-5 had 99% identity to the published EHV-5 sequence, and it was clearly distinguishable from other EHV (1–4) by virus-specific PCR assays. Prevalence of EHV-5 infection in a group of young racehorses was estimated at 64% using the EHV-5 specific PCR on nasopharyngeal secretions.
Key Words: Electron microscopy • equine herpesvirus-5 • PCR • virus isolation
Horses are commonly infected by 5 distinct equine herpesviruses (EHV): the alphaherpesviruses EHV-1, 3, and 4 and the gammaherpesviruses EHV-2 and 5.1 Equine herpesvirus-1 is the cause of abortion and encephalomyelitis in horses, whereas EHV-4 typically results in respiratory disease in susceptible animals. Equine herpesvirus-3 is responsible for genital infection of stallions and mares (coital exanthema). The pathogenic significance of the equine gammaherpesviruses (EHV-2 and 5) is uncertain, but they may cause upper respiratory tract disease, generalized malaise and fever, pharyngitis, and enlarged lymph nodes in young horses.4 Equine gammaherpesvirus-5 has also been implicated in the pathogenesis of a distinctive syndrome of pulmonary fibrosis of adult horses (Williams KJ, Jackson CA, Scott MA, et al.: 2005, Multinodular equine pulmonary fibrosis: a newly recognized herpesvirus-associated respiratory disease of horses, Annual Meeting of the American College of Veterinary Pathologists and American Society of Clinical Pathology, Vet Pathol 42:716, 2005), and EHV-2 may predispose foals to Rhodococcus equi infection.14 The equine herpesviruses are likely spread by respiratory infection, and the viruses are periodically excreted in the nasal secretions of infected horses. Equine gammaherpesvirus-2 latently infects B lymphocytes5 and can be isolated from the peripheral blood mononuclear cells (PBMC) of approximately 90% of apparently healthy horses.12,15 Coinfection of individual horses with EHV-2 and EHV-5 is common, although EHV-5 infection is less prevalent than EHV-2.13
Whereas EHV-2 has been repeatedly isolated from horses around the world, there are few descriptions of the isolation of EHV-5.1,3,6,7,,11 We describe the isolation of EHV-5 from the PBMC of a healthy 8-year-old Appaloosa gelding in California. PBMC were isolated by centrifugation in a commercial cell preparation tube according to the manufacturer's instructions.a Briefly, PBMC were washed in phosphate buffered saline (PBS),b centrifuged three times at 1600 x g, counted, and resuspended in PBS. Peripheral blood mononuclear cells (10 x 106) were inoculated onto a confluent monolayer of rabbit kidney (RK-13) cellsc in a 25-ml flask. Rabbit kidney-13 cells have previously been used to isolate EHV-5.1,6–9 The inoculated culture was screened by virus-specific polymerase chain reaction (PCR) assays using primer pairs specific for EHV-1–5.10, 17 No EHV were detected at 3 days after inoculation, whereas EHV-5 nucleic acids were detected at 7 days. There was no cytopathic effect (CPE) evident in the culture that was positive by EHV-5 PCR; thus, the virus was serially passaged repeatedly on RK-13 cells, with frequent monitoring for CPE. Inoculated cultures were frozen at –80°C and then thawed between each serial passage. Hydrocortisoned (1 µg/ml) was added to the RK-13 medium at passage 5 and thereafter in an attempt to increase cell susceptibility to infection.18 Foci of round, refractile cells consistent with the CPE produced by equine gammaherpesviruses1 were first observed on the 13th day of serial passage 12. Lysates of this cell culture were positive for EHV-5 nucleic acids by PCR, whereas EHV 1–4 were not detected (Fig. 1). Additional published primers13 specific for a 344-base-pair (bp) section of the EHV-5 glycoprotein H (gH) gene were also used to PCR amplify this portion of the virus contained in the cell culture lysate to confirm its authenticity as EHV-5 (Fig. 2).
View larger version (30K):
[in this window]
[in a new window]
|
Figure 1 PCR amplification of EHV 1–5 using virus-specific primers.10,17 Molecular weight (MW) markers (100 base pairs [bp]) are included at the left of each gel. A, numbers at the top of each lane designate both the EHV primer specificity and template (EHV-1, 2, 3, 4, and 5). Primers specific for EHV 1–5 produced individual PCR products of the expected size when applied to their respective templates. Specific primers applied to EHV-1 (ATCC VR-2229) produced a 636-bp product, EHV-2 (courtesy of Dr. William McCollum, University of Kentucky) a 444-bp product, EHV-3 (ATCC VR-352) a 520-bp product, EHV-4 (ATCC VR-2230) a 509-bp product, and EHV-5 a 293-bp product. B, the EHV-5 template was used in all lanes, and numbers at the top of each lane designate primer specificity (EHV 1–5). Primers specific for EHV 1–4 did not generate any PCR product, whereas a product of the expected size (293 bp) was produced with the primers specific for the EHV-5 gB gene. C, confirms the specificity of these EHV-5 specific primers. Lane 1 contains as template 300,000 plasmid copies containing EHV-5 gB, lane 2: 30,000 copies, lane 3: 3,000 copies, lane 4: 300 copies, and lane 5 contains the cell culture propagated EHV-5. A PCR product of the expected size (293 bp) is produced in each lane.
|
|
View larger version (90K):
[in this window]
[in a new window]
|
Figure 2 PCR amplification of EHV-5 using primers specific for the EHV-5 gH gene.13 These primers were applied to EHV 1–5 templates (designated by numbers above lane). A PCR product of the expected size (344 bp) was produced only with the EHV-5 template. 100-bp molecular weight markers (MW) and a water template (w) are provided at the left of the gel.
|
|
Lysates of the EHV-5 positive RK-13 culture were prepared for electron microscopic (EM) examination by mixing cell culture lysate with 2% phosphotungstate (pH 7.4) to form a slurry that was applied to a formvar/carbon coated 300 mesh copper grid and examined in a transmission electron microscopee at 60 kv accelerating voltage. Numerous virions with typical herpesvirus morphology were demonstrated in cell lysate by negative contrast EM (Fig. 3).
View larger version (155K):
[in this window]
[in a new window]
|
Figure 3 Transmission electron micrographs of virions with characteristic herpesvirus morphology. Bar = 100 nm.
|
|
The virus isolate was tentatively identified as EHV-5 by PCR amplification of a 293-bp section of the EHV-5 glycoprotein B (gB) gene using previously described primers.10 To unequivocally confirm the identity of this virus isolate, a 701-bp section of the gB gene of EHV-5 was amplified by PCR from nucleic acids extractedf from cell culture lysate at culture passages 2 and 12, using a forward primer (5' TAGCATGGAAGAAAACTTGGCAA 3') based on the published sequence of EHV-5 gB (GenBank accession number AF050671) and the previously described reverse primer (5' CACGTTCACTATCACGTCGC 3').10 The PCR product was gel purified with a commercial kitg and sequenced by automated fluorescent cycle sequencing.h Nucleotide sequences were aligned and phylogenetic relationships estimated among various herpesviruses using computer software.i,j,16 The sequences of the PCR products amplified from cell culture passages 2 and 12 were identical, and exhibited 99% identity to the published EHV-5 sequence. The sequence and phylogenetic analysis confirm that the virus isolated is EHV-5, as this portion of the gB gene differs markedly among the EHV (Fig. 4). Whereas the PCR product amplified at passage 2 might reflect nucleic acid from latently infected lymphocytes still present in the culture, the fact that the sequences at passage 2 and 12 were identical indicates that there were no alterations in this portion of the gB gene during repeated passage. Furthermore, the freeze-thaw steps between each serial passage would have lysed any contaminating lymphocytes in the culture, indicating that virus detected at passage 12 was replicating in the RK-13 cells.
View larger version (10K):
[in this window]
[in a new window]
|
Figure 4 Unrooted phylogenetic tree based on the nucleotide sequences of a homologous 701-bp section of the gB gene of EHV-1 (GenBank accession no. NC_001491), EHV-2 (NC_001650), EHV-4 (NC_001844), EHV-5 (AF050671), Human Herpesvirus 1 or HHV-1 (NC_001806), and the California isolate of EHV-5 (designated KD05). Note the colocalization of EHV-5 KD05 and the published EHV-5 sequence (AF050671). A common scale bar is indicated for divergence (i.e., substitutions per nucleotide site). Nucleotide sequence of the gB gene of EHV-3 was not available.
|
|
The prevalence of EHV-5 infection of horses in North America apparently has not been reported. Thus, nasopharyngeal swabs were collected as previously described from 47 healthy racehorses (aged 2–6 years) in training in southern California.2 Equine gammaherpesvirus-5 was detected in the nasal secretions of 30/47 (64%) of these horses by virus-specific PCR.10
In summary, although EHV-5 infection of horses is common, there are few published descriptions of the isolation of this virus. To the authors' knowledge, this is the first description of the isolation of EHV-5 in the Americas.
|
Acknowledgments
|
|---|
The authors gratefully acknowledge Casey and Kelly DeCino for their assistance, as well as owners and veterinarians of the racing horses evaluated. This study was supported by the Center for Equine Health, University of California, Davis with funds provided by the Edwin J. Gregson Fellowship in Equine Studies and the Harriet E. Pfleger Foundation, and by the Southern California Equine Foundation with funds provided by the Dolly Green Research Foundation.
|
Sources and manufacturers
|
|---|
From the Equine Viral Disease Laboratory, Department of Pathology, Microbiology, and Immunology (Bell, Balasuriya, MacLachlan), and the California Animal Health and Food Safety Laboratory (Nordhausen), School of Veterinary Medicine, University of California, Davis, CA 95616. Current address (Balasuriya): the Department of Veterinary Science, 108 Maxwell H. Gluck Equine Research Center, University of Kentucky, Lexington, KY 40546-0099. 
a. BD Vacutainer CPT, BD, Franklin Lakes, NJ.
b. Gibco, Invitrogen, Carlsbad, CA.
c. American Type Culture Collection, CCL 37, Manassas, VA.
d. Sigma-Aldrich Co., St. Louis, MO.
e. Zeiss, 906 E transmission electron microscope, Oberkochen, Germany.
f. QIAamp, Qiagen, Valencia, CA.
g. Qiaquick, Qiagen, Valencia, CA.
h. Davis Sequencing, Davis, CA.
i. Vector NTI, Invitrogen, Carlsbad, CA.
j. PAUP* 4.0 Beta, Sinauer Associates, Inc., Sunderland, MA.
|
References
|
|---|
- Agius C.T., Studdert M.J.: 1994, Equine herpesviruses 2 and 5: comparisons with other members of the subfamily gammaherpesvirinae. Adv Virus Res 44:357–379.[Medline]
- Balasuriya U.B., Snijder E.J., van Dinten L.C., et al.: 1999, Equine arteritis virus derived from an infectious cDNA clone is attenuated and genetically stable in infected stallions. Virology 260:201–208.[Medline]
- Borchers K., Frolich K., Ludwig H.: 1999, Detection of equine herpesvirus types 2 and 5 (EHV-2 and EHV-5) in Przewalski's wild horses. Arch Virol 144:771–780.[Medline]
- Browning G.F., Studdert M.J.: 1988, Equine herpesvirus 2 (equine cytomegalovirus). Vet Bull 58:775–790.
- Drummer H.E., Reubel G.H., Studdert M.J.: 1996, Equine gammaherpesvirus 2 (EHV2) is latent in B lymphocytes. Arch Virol 141:495–504.[Medline]
- Dunowska M., Holloway S.A., Wilks C.R., Meers J.: 2000, Genomic variability of equine herpesvirus-5. Arch Virol 145:1359–1371.[Medline]
- Dunowska M., Meers J., Wilks C.R.: 1999, Isolation of equine herpesvirus type 5 in New Zealand. New Z Vet J 47:44–46.
- Dunowska M., Wilks C.R., Studdert M., Meers J.: 2002, Equine respiratory viruses in foals in New Zealand. New Z Vet J 50:140–147.
- Dunowska M., Wilks C.R., Studdert M., Meers J.: 2002, Viruses associated with outbreaks of equine respiratory disease in New Zealand. New Z Vet J 50:132–139.
- Dynon K., Varrasso A., Ficorilli N., et al.: 2001, Identification of equine herpesvirus 3 (equine coital exanthema virus), equine gammaherpesviruses 2 and 5, equine adenoviruses 1 and 2, equine arteritis virus and equine rhinitis A virus by polymerase chain reaction. Aust Vet J 79:695–702.[Medline]
- Franchini M., Akens M., Bracher V., von Fellenberg R.: 1997, Characterisation of gamma herpesviruses in the horse by PCR. Virology 238:8–13.[Medline]
- Kemeny L., Pearson J.E.: 1970, Isolation of herpesvirus from equine leukocytes: comparison with equine rhinopneumonitis virus. Can J Comp Med 34:59–65.[Medline]
- Nordengrahn A., Merza M., Ros C., et al.: 2002, Prevalence of equine herpesvirus types 2 and 5 in horse populations by using type-specific PCR assays. Vet Res 33:251–259.[Medline]
- Nordengrahn A., Rusvai M., Merza M., et al.: 1996, Equine herpesvirus type 2 (EHV-2) as a predisposing factor for Rhodococcus equi pneumonia in foals: prevention of the bifactorial disease with EHV-2 immunostimulating complexes. Vet Microbiol 51:55–68.[Medline]
- Roeder P.L., Scott G.R.: 1975, The prevalence of equid herpes virus 2 infections. Vet Rec 96:404–405.[Medline]
- Saitou N., Nei M.: 1987, The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425.[Abstract]
- Varrasso A., Dynon K., Ficorilli N., et al.: 2001, Identification of equine herpesviruses 1 and 4 by polymerase chain reaction. Aust Vet J 79:563–569.[Medline]
- Weinstein B.I., Schwartz J., Gordon G.G., et al.: 1982, Characterization of a glucocorticoid receptor and the direct effect of dexamethasone on herpes simplex virus infection of rabbit corneal cells in culture. Invest Ophthalmol Vis Sci 23:651–659.[Abstract/Free Full Text]
This article has been cited by other articles:
|
|
|
|
 
Z. Lu, A. J. Branscum, K. M. Shuck, J. Zhang, E. J. Dubovi, P. J. Timoney, and U. B.R. Balasuriya
Comparison of two real-time reverse transcription polymerase chain reaction assays for the detection of Equine arteritis virus nucleic acid in equine semen and tissue culture fluid
J Vet Diagn Invest,
March 1, 2008;
20(2):
147 - 155.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. J. Williams, R. Maes, F. Del Piero, A. Lim, A. Wise, D. C. Bolin, J. Caswell, C. Jackson, N. E. Robinson, F. Derksen, et al.
Equine Multinodular Pulmonary Fibrosis: A Newly Recognized Herpesvirus-Associated Fibrotic Lung Disease
Vet. Pathol.,
November 1, 2007;
44(6):
849 - 862.
[Abstract]
[Full Text]
[PDF]
|
|
|
TOP
Abstract
References
