|
|
||||||||
Full Scientific Reports |
Correspondence: 1 Corresponding Author: Robert.A Kunkle, DVM, PhD, National Animal Disease Center, ARS, USDA, 2300 Dayton Avenue, PO Box 70, Ames, IA 50010. rkunkle{at}nadc.ars.usda.gov
| Abstract |
|---|
|
|
|---|
Key Words: Gene sequencing paraffin-embedded tissue prion scrapie sheep
| Introduction |
|---|
|
|
|---|
Immunohistochemical (IHC) detection of PrPsc in lymphoid or CNS tissues of sheep is sufficient for the diagnosis of preclinical, as well as clinical scrapie. Commonly used IHC procedures utilize formalin-fixed, paraffin-embedded tissues (PET), as does routine histologic examination. In cases of clinical scrapie, histopathologic findings include neuronal vacuolar degeneration and loss, astrocytosis, and generalized microscopic vacuolation of neuropil in the CNS. Lesions are often inapparent in preclinical cases, for which diagnosis is achieved by detection of PrPsc.
The susceptibility of sheep to scrapie is greatly influenced by host PrP gene alleles. Amino acid polymorphisms corresponding to the codons 136 and 171 are major determinants of relative susceptibility.8,9 Residue 154 also has been found to influence scrapie susceptibility in a sheep breed.4 The 5 common allelic variations, resulting from amino acid substitutions involving alanine (A), valine (V), arginine (R), histidine (H), and glutamine (Q), are A136R154R171, A136R154H171, A136H154Q171, A136R154Q171, and V136R154Q171.2 Nine other polymorphic sites (112, 127, 137, 138, 141, 143, 151, 176, and 211) also have been identified.13 The V136 and Q171 haplotypes are linked to scrapie susceptibility, especially in the homozygous state.4,8,9 Although the predictive value of PrP genotype in determining the eventuality of scrapie in an individual is not absolute, the VRQ/VRQ genotype is strongly associated with susceptibility, and the ARR/ARR genotype is strongly associated with resistance.4,7 Therefore, sheep PrP gene polymorphisms found within a flock can determine recommendations for selective breeding to reduce or prevent scrapie occurrence.3
Determination of sheep PrP alleles typically has required extraction of DNA from host tissues such as blood, semen, buccal epithelial cells, brain, or potentially, almost all other tissues that are freshly derived or stored frozen .9,1519 These techniques are amenable to flock surveys, prospective studies, or retrospective analyses where fresh-frozen tissues are available. Retrospective studies to correlate PrP genetics and scrapie incidence can be problematic in instances where diagnosis is determined by IHC analysis and histologic examination but fresh tissues are not collected or frozen tissues are not available. The study reported here describes modifications of a previously published technique11 for extraction of DNA from formalin-fixed, paraffin-embedded, sheep tissues that allow nucleotide sequencing of a segment of the PrP gene that encompasses codons 136 and 171.
| Materials and Methods |
|---|
|
|
|---|
Extraction of DNA from PET was based on a previously described method for crude extracts and purified preparations.11 In brief, a crude tissue extract was obtained from 2 PET sections (each 5-µm thick) collected into a 1.5-ml microcentrifuge tube and pelleted by centrifugation at 16,000 x g for 1 min, followed by the addition of 200 µl of 0.05 M Tris (pH 7.5), 1 mM EDTA, and 0.5% Tween 20. The tube was then placed in a 100°C water bath for 10 min followed by snap-freezing (ethanol on dry ice); the 10-min boil and snap-freezing were repeated, followed by 1 more 10-min boil, and then were immediately centrifuged at 3,000 x g for 10 min to separate the paraffin while pelleting the tissue. Proteinase Ka was added to the extract, via pipette tip through the resolidified paraffin overlay, to a final concentration of 0.5 U/ml (approx. 0.2 mg/ml) followed by incubation in a 42°C water bath for 1620 hr. The inactivation of residual proteinase K was achieved by snap-freezing in cold ethanol and then a 10-min boil. The tissue debris was pelleted by centrifugation at 3,000 x g for 20 min. Supernatant was used either as crude extract or purified prior to amplification. Extracts were purified by removal of extraneous protein using a precipitating compoundb followed by addition of LiCl (0.5 M final concentration) to the supernatant prior to ethanol precipitation of the DNA. The purified DNA preparation was pelleted by centrifugation, dried, and resuspended in 50 µl of a special water.c Target DNA amplification from either crude extract or purified preparation used a 3- to 20-µl volume of the suspension, equivalent to 0.51.0 µg of DNA, as determined by spectroscopic absorbance at 260 nm, in an amplification reaction mixture of a 100-µl total volume.
Each sample was amplified using a primer set,d producing a 304-nucleotide fragment encompassing codons 136171 of the sheep PrP gene, designated as 4142 TGGAACAAGCCCAGTAAGCC and 9612 GGTGAAGTTCTCCCCTTGGT.1 Other than the oligonucleotide primers used, amplification reaction mastermix was prepared as described.11 The reaction mixture consisted of 80 µl of reaction mastermix and 20 µl of test sample. Amplification conditions were 5 min at 94°C for DNA polymerase activation and initial denaturation of target DNA; 50 cycles of 1 min at 94°C, 30 sec at 60°C, and 2 min at 72°C; and a final extension period of 10 min at 72°C. The amplification products were kept at 4°C for up to 18 hr prior to analysis by agarose gel electrophoresis, staining with ethidium bromide, and visualization with ultraviolet light. Amplified product was purified by use of a centrifugal filter devicee prior to sequencing with oligonucleotides 4142 and 9612. Products were quantitated using the Pico Green assay for double stranded (ds)DNA.f The appropriate quantity of dsDNA PCR product was labeled in both directions using a terminator chemistry productg according to manufacturer's instructions. The labeled products were sequenced using a genetic analyzer.h Primers used for sequencing were identical to those used in the primary PCR reaction. Interpretation of sequence data was facilitated by use of special software.i
Determination of ovine PrP gene polymorphisms of codons 136 and 171 using freshly frozen brainstem obtained from the 54 sheep delivered to the NADC was performed as described.17 The 40 sheep brainstem submissions to NVSL included fresh and formalin-fixed specimens; codon-136 and codon-171 amino acid polymorphism data obtained from fresh tissue (blood) was supplied from a commercial source.j
| Results |
|---|
|
|
|---|
|
Two sheep brainstem specimens were portioned and immersed in formalin for 7, 15, 31, or 70 days prior to processing in paraffin blocks; the duration of formalin fixation affected neither the ability to amplify target DNA nor to produce readable sequence of DNA amplicon.
| Discussion |
|---|
|
|
|---|
This PET DNA extraction method, principally consisting of repeated cycles of boiling and freezing, was originally applied to the PCR-based diagnosis of mycobacterioses,1012 diseases in which serologic diagnosis is confounded by cross-reactive dominant antigens, and isolation is delayed by the indolent growth characteristics of the bacteria. Application of the method to PrP genotyping for retrospective studies should be a simple undertaking for any institution currently using this particular technique for diagnosis of tuberculosis.
The majority (72/94) of PET samples examined were sequenced on the first attempt after amplification of crude DNA extracts, and a further 14 samples after a second attempt. These 14 initial failures may have more to do with variable amounts of tissue DNA in PET sections than the quality of DNA in the crude extract preparations since only 6 of 94 required preparations of purified DNA for amplification of sequence-ready product. The 2 of 94 failures to obtain PCR product from PET probably reflect inherent limitations of the method, as neither repeat extractions of serial sections nor purification of DNA extracts affected the outcome. Variables such as composition of fixative, storage conditions during fixation, tissue dehydration conditions, quantity of sectioned tissue, or density of cell nuclei in the PET could affect recovery of suitable quality or quantity of DNA.
There was no apparent influence on the ability to amplify and sequence 2 sets of sheep brainstem PET when formalin fixation was extended from 7 to 70 days. However, as a general rule, the longer the fixation period, the more problematic amplification of extracted DNA becomes. Because of the degradation of nucleic acids in formalin-immersed tissues, it is recommended that primers for amplification of short DNA stretches (< 200 base pairs) be used for DNA isolated from fixed specimens.6 In this study, use of the 4142/9612 primer set, which yields a small (304 bases) amplification product, may have limited the influence of formalin-induced DNA damage. A fixation period beyond 10 weeks would probably have lessened the efficiency of amplification, but that time frame was not established in this study.
The benefit of using PET as the source of DNA for prion genotype sequencing is relevant in instances where scrapie is diagnosed by histologic examination or IHC analysis, or both, and fresh tissues are not available. These instances arise when tissues are not collected appropriately or when freezer malfunction spoils stored frozen tissues.
As found in this study, mislabeled samples or recording errors could lead to discrepant results when tissue samples are divided for separate processing and analysis. Robust quality-control protocols are necessary to identify tissue handling mix-ups, and even when discovered, errors of this type typically are difficult to resolve. A variety of suspected clerical errors were uncovered in this study after some initial confusion over dissimilar sequence data obtained from 5 "matched" fixed and nonfixed samples; investigation of records and additional analysis apparently resolved 3 of these cases, but the discrepancies remain unresolved for 2 animals.
The stability of PET for the purpose of histologic examination is virtually unlimited, and institutionally maintained PET archives are common for this reason. Likewise, it can be reasonably assumed that consistent IHC results will be obtained from archived PET, though it may depend on the specific application. In the authors' experience, comparable PrP IHC results are obtained with PET sectioned years apart. The "shelf-life" of DNA in PET may be more limited. Duration of storage in paraffin block form for longer than 4 years has produced extracted DNA fragments of diminished size,5 and decreased efficiency of PCR amplification has been reported for PET stored for 5 years or longer.6 However, longer storage may not affect generation of small amplicons; successful amplification of 58- and 116-base pair fragments has been reported for DNA extracted from PET samples stored for 16 years.14 In the study reported here, 54 of the PET had been embedded in paraffin 67 years prior to sectioning for DNA extraction, and amplified product was obtained from 52 specimens. The better-than-expected success rate may be attributed to the extraction method's minimalized steps for deparaffinization or recovery of template target DNA. Genotyping of relevant polymorphic sites from archived sheep PET would allow retrospective studies to augment our current understanding of the epidemiologic link between prion genetics and scrapie occurrence. Retrospective studies aside, submission of nonfixed tissues remains essential, as they are the most efficient method of DNA extraction for determination of sheep PrP gene polymorphisms.
| Acknowledgments |
|---|
Disclaimer: Mention of trade names or commercial products in this report is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture.
| Sources and manufacturers |
|---|
|
|
|---|
b. Procipitate, Ligochem, Fairfield, NJ. ![]()
c. Omnisolv, EM Science, Gibbstown, NJ. ![]()
d. Integrated Technologies, Coralville, IA. ![]()
e. Microcon YM-100, Amicon Corp., Bedford, MA. ![]()
f. Invitrogen Corporation, Carlsbad, CA. ![]()
g. Big Dye, Applied Biosystems Inc., Foster City, CA. ![]()
h. ABI 3100, Applied Biosystems Inc., Foster City, CA. ![]()
i. SeqMan II (version 5.08) Lasergene, DNASTAR, Inc., Madison, WI. ![]()
j. Gene Check, Fort Collins, CO. ![]()
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. A. Kunkle, E. M. Nicholson, S. Lebepe-Mazur, D. L. Orcutt, M. L. Srinivas, J. J. Greenlee, D. P. Alt, and A. N. Hamir Western blot detection of PrPSc in archived paraffin-embedded brainstem from scrapie-affected sheep J Vet Diagn Invest, July 1, 2008; 20(4): 522 - 526. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Ramos-Vara, C. C. Wu, T. L. Lin, and M. A. Miller Nocardia tenerifensis genome identification in a cutaneous granuloma of a cat J Vet Diagn Invest, September 1, 2007; 19(5): 577 - 580. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |